View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0480_high_4 (Length: 251)
Name: NF0480_high_4
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0480_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 36717012 - 36717234
Alignment:
| Q |
1 |
aatgtttgtctgtcatattaatcgtgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtcacacgaaaatccatcata |
100 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717012 |
aatgtttgtctttcatattaatcttgttaaggaaaatgatatcttcactccggcaatagatggatctattctgcctggggtcacacgaaaatccatcata |
36717111 |
T |
 |
| Q |
101 |
gaaatcgccattgatttgggttataaggtatttatgtttccctcccaatgtgtgccattattttctacaaatttacaatatagatgattaatgatttatg |
200 |
Q |
| |
|
|| || ||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36717112 |
gacattgccattgatttgggttataaggtatttatttttccctcccaatgtttgccattattttctacaaatttacaatatagatgattaatgatttatg |
36717211 |
T |
 |
| Q |
201 |
gctataaacttacaaaagaaatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36717212 |
gctataaacttacaaaagaaatt |
36717234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University