View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0480_low_2 (Length: 510)
Name: NF0480_low_2
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0480_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 12 - 419
Target Start/End: Complemental strand, 52858083 - 52857681
Alignment:
| Q |
12 |
atgatccggaccttcttctacattgcctcaatgcgctcgaaactcaggtactatctcttttcacaatattaattcttcatccacaaccacattatttcat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52858083 |
atgatccggaccttcttctacattgcctcaatgcgctcgaaactcaggtactatctcttttcacaatattaattcttcatccacaaccacattatttcat |
52857984 |
T |
|
| Q |
112 |
tttttaattactaattcaatatttctactccttaatcacctaattcagtatagtctcccacaaacttctctcgaaatggaccagcttatgcataatattc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52857983 |
tttttaattactaattcaatatttctactccttaatcacctaattcagtatagtctcccacaaacttctctcgaaatggaccagcttatgcataatattc |
52857884 |
T |
|
| Q |
212 |
cccaagattctgtcccttgtaaaatccgtgccaagcgtggatgtgccactcatcctcgtagcattgctgaacgggtaattaattcattcattactctact |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52857883 |
cccaagattctgtcccttgtaaaatccgtgccaagcgtggatgtgccactcatcctcgtagcattgctgaacgggtaattaattcattcattactctact |
52857784 |
T |
|
| Q |
312 |
ccactctttcctttttctttctacttatgtctttgaatataacaactctattgcattacatgtatgcaggagagaagaactagaataagtggcaagttga |
411 |
Q |
| |
|
| | |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52857783 |
cta-----tcctttttctttctacttctgtctttgaatataacaactctattgcattacatgtatgcaggagagaagaactagaataagtggcaagttga |
52857689 |
T |
|
| Q |
412 |
agaagttg |
419 |
Q |
| |
|
|||||||| |
|
|
| T |
52857688 |
agaagttg |
52857681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 229 times since January 2019
Visitors: 3465