View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0480_low_4 (Length: 292)
Name: NF0480_low_4
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0480_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 17597503 - 17597261
Alignment:
| Q |
1 |
caccaataacaccaagttcaggacaatcagcccattccaacaattctgtcaaaaccaaagagtttcttccttttccatgacctaaaatatatagatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17597503 |
caccaataacaccaagttcaggacaatcagcccattccaacaattctgtcaaaaccaaagagtttcttccttttccatgacctaaaatatatagatcaaa |
17597404 |
T |
|
| Q |
101 |
ccctaatttgtccaattcttcaagcactataggaatgtcttcaccagtatgcacttctctttcttcataagttatagtatcctcattgttcactgcctta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17597403 |
ccctaatttgtccaattcttcaagcactataggaatgtcttcaccagtatgcacttctctttcttcataagttatagtatcctcattgttcactgcctta |
17597304 |
T |
|
| Q |
201 |
agtcgaaacgaacctacacggtcttcgtccaactctctctgct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17597303 |
agtcgaaacgaacctacacggtcttcgtccaactctctttgct |
17597261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1556 times since January 2019
Visitors: 3458