View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0480_low_8 (Length: 251)
Name: NF0480_low_8
Description: NF0480
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0480_low_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 30 - 251
Target Start/End: Complemental strand, 47192303 - 47192083
Alignment:
| Q |
30 |
atagatttattcacagtttcaaacaaccatcaaacatccctacattggtaaagaatgacattcaatcagaaatttggaaacaacaatcaaagtatacctt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47192303 |
atagatttattcacagtttcaaacaaccatctaacatccctacattggtaaagaatgacattcaatcagaaatttggaaacaacaatcaa-gtatacctt |
47192205 |
T |
|
| Q |
130 |
taatgtaaactgatataaagattttgaacaaaaaataaataaaccaagagaaatgaaatggaggtcaaacaataggagtcttcttagggttgattaaggc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47192204 |
taatgtaaactgatataaagattttgaacaaaaaataaataaaccaagagaaatgaaatggaggtcaaacaataggagtctttttagggttgattaaggc |
47192105 |
T |
|
| Q |
230 |
actaacccataatattcatgaa |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47192104 |
actaacccataatattcatgaa |
47192083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1293 times since January 2019
Visitors: 3440