View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_high_9 (Length: 288)
Name: NF0482_high_9
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 19 - 165
Target Start/End: Original strand, 4261677 - 4261836
Alignment:
Q |
19 |
gaatacatccattgtatacattaattttataacagtcattttgtagttgaagacatagacacaatcgatcaaacttcgtgatc--------------aat |
104 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
4261677 |
gaatacatccattgtatacattaattttataacagtcattttgtagttgaagacatagacacaatcgatcaaacttcgtgatcaatcatgagtttttaat |
4261776 |
T |
 |
Q |
105 |
tatttgcgtttatttatctgttttccttagagtgctttattttctaatagattaaagatat |
165 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
4261777 |
tatttgcgtttatttatctgttttccttagagtgc-ttattttctaatagattaaagatat |
4261836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 141 - 225
Target Start/End: Original strand, 24273707 - 24273790
Alignment:
Q |
141 |
ttattttctaatagattaaagatatagcaaggtcttagcaatgatctcaaccttggttaatgtaactgaaactcttaaatactta |
225 |
Q |
|
|
||||||||||||||||| |||||||| ||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
T |
24273707 |
ttattttctaatagattgaagatatat-aaggtctaagcaatgatctccaccttggttaatgtaattgaaactcttaaatactta |
24273790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 4036554 - 4036478
Alignment:
Q |
144 |
ttttctaatagattaaagatatagcaaggtcttagcaatgatctcaaccttggttaatgtaactgaaactcttaaat |
220 |
Q |
|
|
|||||| ||||||| ||||||||| |||| | ||||||||| |||| ||||||||||||| |||| ||||||||| |
|
|
T |
4036554 |
ttttctgatagattgaagatatagtaaggaataagcaatgatttcaagtttggttaatgtaattgaagctcttaaat |
4036478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 225
Target Start/End: Complemental strand, 24091089 - 24091025
Alignment:
Q |
161 |
gatatagcaaggtcttagcaatgatctcaaccttggttaatgtaactgaaactcttaaatactta |
225 |
Q |
|
|
||||||| ||||| | ||||||||||||||| ||||||||||||| |||| |||||||||||||| |
|
|
T |
24091089 |
gatatagtaaggtataagcaatgatctcaacattggttaatgtaattgaagctcttaaatactta |
24091025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 247 times since January 2019
Visitors: 3467