View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_10 (Length: 351)
Name: NF0482_low_10
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_10 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 93 - 351
Target Start/End: Complemental strand, 36743088 - 36742839
Alignment:
| Q |
93 |
caacaacgtctctaacaagaccaaatccagctccaagtgaagggccagctttaatatcattcaaatccaatgcattcttgcacatcaacaccactgttcc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36743088 |
caacaacgtctctaacaagaccaaatccagctccaagtgaagggccagctttaatatcattcaaatccaatgcattcttgcacatcaacaccactgttcc |
36742989 |
T |
|
| Q |
193 |
cttaatcttttgcttcttcttgaaaaggggaaacatcttgaatgattttgattggcttaagtttgagataagtgaagttaagagaagaagaaacttgtgt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36742988 |
cttaatcttttgcttcttcttgaaaaggggaaacatcttgaatgattttga-----------ttgagataagtgaagttaagagaagaagaaacttgtgt |
36742900 |
T |
|
| Q |
293 |
ggaagaggaagacataaccatgctatttataggggag--atataagaactaaactatggta |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36742899 |
ggaagaggaagacataaccatgctatttataggggagaaatataagaactaaactatggta |
36742839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 122 times since January 2019
Visitors: 3464