View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_12 (Length: 333)
Name: NF0482_low_12
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 1e-69; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 83 - 220
Target Start/End: Original strand, 31719821 - 31719958
Alignment:
Q |
83 |
tgagatgaatatagacgtttaattgctgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtc |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31719821 |
tgagatgaatatagacgtttaattgctgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtc |
31719920 |
T |
 |
Q |
183 |
taagtttaagtcccacaccgttcaatagtgttgtaaat |
220 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||| |
|
|
T |
31719921 |
taagtttaagtcccacaccgttcaacagtgttgtaaat |
31719958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 109 - 193
Target Start/End: Complemental strand, 31011773 - 31011689
Alignment:
Q |
109 |
tgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagtttaagt |
193 |
Q |
|
|
|||||||||||||||||||||||||| | |||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
T |
31011773 |
tgctattcatgctgggaagcctaaaggtggaatagtggaatgtctcaaagtggagcctgataaagtgagacgtctaagtttaagt |
31011689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 109 - 193
Target Start/End: Original strand, 31709549 - 31709633
Alignment:
Q |
109 |
tgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagtttaagt |
193 |
Q |
|
|
|||||| ||||||||||||||||||| | |||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
T |
31709549 |
tgctatacatgctgggaagcctaaaggtggaatagtggaatgtctcaaagtggagcctgataaagtgagacgtctaagtttaagt |
31709633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 204 times since January 2019
Visitors: 3465