View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_13 (Length: 333)
Name: NF0482_low_13
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 90 - 259
Target Start/End: Original strand, 45414589 - 45414769
Alignment:
| Q |
90 |
gattcgtaccgatgggcgtttgtgtttggcta---atcatcaatcatcatcannnnnnnnnnnnnnnnnnnaactgaatttccaattttcttcattcatc |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45414589 |
gattcgtaccgatgggcgtttgtgtttggctaatcatcatcaatcatcatcatcctcctcctcctccctccgactgaatttccaattttcttcattcatc |
45414688 |
T |
|
| Q |
187 |
cgtacacgtgtc--------tctttctttctttctttctgatcaattgatttgctatggagtcaccgattatcttcatctc |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45414689 |
cgtacacgtgtctctttctttctttctttctttctttctgatcaattgatttgctatggagtcaccgattatcatcatctc |
45414769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 322 times since January 2019
Visitors: 3470