View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_18 (Length: 318)
Name: NF0482_low_18
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 89 - 289
Target Start/End: Complemental strand, 54803 - 54603
Alignment:
| Q |
89 |
aaagtattgaaatccaatgnnnnnnnnnccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgtt |
188 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54803 |
aaagtattgaaatccaatgaaaaaaaaaccatagattacatttcaatattattagctagatagattacatgatggaacatgcatttacattgtcatcgtt |
54704 |
T |
|
| Q |
189 |
aaaaagggagacaagtaattcttcttgatgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccagagggtgcccttttgtcatag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54703 |
aaaaagggagacaagtaattcttcttgatgattggatgaggccataggggcagcctgcacaacgtttctaacaaatccagagggtgcccttttgtcatag |
54604 |
T |
|
| Q |
289 |
g |
289 |
Q |
| |
|
| |
|
|
| T |
54603 |
g |
54603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 518 times since January 2019
Visitors: 3481