View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0482_low_20 (Length: 313)

Name: NF0482_low_20
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0482_low_20
NF0482_low_20
[»] chr6 (2 HSPs)
chr6 (94-195)||(7814277-7814378)
chr6 (84-183)||(7860208-7860307)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 94 - 195
Target Start/End: Complemental strand, 7814378 - 7814277
Alignment:
94 ttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacacgacgctgtttcgccgcttcaaaccatgcactgaagatgtgactatattg 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||| ||||||| |||| ||| |||||| |||    
7814378 ttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacactacgctgttttgcggcttcaatccatgcattgaatatgcgactatcttg 7814279  T
194 ct 195  Q
    ||    
7814278 ct 7814277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 84 - 183
Target Start/End: Complemental strand, 7860307 - 7860208
Alignment:
84 gagatgaaagttatgggattcaaggtgtggaaatccatatgaagattaatttcctcaacacgacgctgtttcgccgcttcaaaccatgcactgaagatgt 183  Q
    ||||||||| | ||||||||||| || ||||||| || ||  ||||  | |||||||||| |||||||||| || ||||||| ||||||| |||||||||    
7860307 gagatgaaaataatgggattcaatgtttggaaatacagatttagatgtaattcctcaacatgacgctgttttgcggcttcaagccatgcattgaagatgt 7860208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University