View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_24 (Length: 283)
Name: NF0482_low_24
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 29 - 263
Target Start/End: Complemental strand, 44995740 - 44995506
Alignment:
Q |
29 |
agatgtaagcataaaattcagtattgttcattcatatggttttaaagtgcagctgtggttatgctatgaccctatatactgtcgaaaaatgcagctaatg |
128 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44995740 |
agatgtaagcataaaattcagtattgttcgttcatatggttttaaagtgcagctgtggttatgctatgaccctatatactgtcgaaaaatgcagctaatg |
44995641 |
T |
 |
Q |
129 |
cgatcaaaattgtcgttgtgatacttcatagactttaaaattattcatatttaggctcttgataggtatgtatgtgactattgttgtgttttcgtgtaag |
228 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44995640 |
cgatcaaaattgtcgttgtgatactgcatagactttaaaattattcatatttaggctcttgataggtatgtatgtgactattgttgtgttttcgtgtaag |
44995541 |
T |
 |
Q |
229 |
gtttgggtttatgggaatagcttcaagtctgtgct |
263 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
44995540 |
gtttgggtttatgggaatagcttcaagtctgtgct |
44995506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1586 times since January 2019
Visitors: 3458