View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_27 (Length: 276)
Name: NF0482_low_27
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 56 - 228
Target Start/End: Complemental strand, 5218457 - 5218285
Alignment:
| Q |
56 |
ttttgctcttgtggcacatagttcctgtgaacgtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaataga |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5218457 |
ttttgctcttgtggcacatagttcctgtgaaagtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaataga |
5218358 |
T |
|
| Q |
156 |
gaaacacaccaaacacgaaatcaacaccgaaatgacacattaaaactgataattatctgagaaaataatataa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
5218357 |
gaaacacaccaaacacgaaatcaacaccgaaatgacacattaaaaccgataattatctgagaaaatgatataa |
5218285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 66 - 234
Target Start/End: Complemental strand, 5218171 - 5218008
Alignment:
| Q |
66 |
gtggcacatagttcctgtgaacgtaaatatacatcttctgtttaatttcatataattgaattagttacttcatatgattaaaacaatagagaaacacacc |
165 |
Q |
| |
|
|||||||||||||||| ||||| |||||| | ||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||||| || | |
|
|
| T |
5218171 |
gtggcacatagttcctatgaacataaataca-----tctatttaatttcatataattgaattagttacttcatatgattgaaacaattgagaaacgcatc |
5218077 |
T |
|
| Q |
166 |
aaacacgaaatcaacaccgaaatgacacattaaaactgataattatctgagaaaataatataattaact |
234 |
Q |
| |
|
|||| | ||||||| ||||||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
5218076 |
gaacataacatcaacatcgaaatgacacattaaaaccaataattatttgaaaaaataatataattaact |
5218008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 205 times since January 2019
Visitors: 3465