View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_28 (Length: 275)
Name: NF0482_low_28
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 47 - 213
Target Start/End: Original strand, 18010894 - 18011056
Alignment:
Q |
47 |
gacatcatcatgacgccataaggtacataattatccttgttgggtttttccaccttgaactacaaccaaaaggacagcgtgcaccaacgttcttggggat |
146 |
Q |
|
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||| |||||||||||| |
|
|
T |
18010894 |
gacatcattatgacgccataaggtacacaattatccttgttgggtttttccaccttgaactgcaaccaaaaagacagc----accaatgttcttggggat |
18010989 |
T |
 |
Q |
147 |
tcctttaagcttgtcgttgatgcaagaagaagattgaaaaagataagtatatgcacatgtatgtatt |
213 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18010990 |
tcctttaagcttgtcattgatgcaagaagaagattgaaaaagataagtatatgcacatgtatgtatt |
18011056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 17923000 - 17923076
Alignment:
Q |
141 |
ggggattcctttaagcttgtcgttgatgcaagaagaagattgaaaaagataagtatatgcacatgtatgtattgttt |
217 |
Q |
|
|
|||||||||| ||||||| || || |||||||||||||||||| |||| | ||||||| | ||||||||||||| |
|
|
T |
17923000 |
ggggattcctacaagcttgacggtggtgcaagaagaagattgaagaagagaggtatatgtatgggtatgtattgttt |
17923076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University