View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0482_low_29 (Length: 268)

Name: NF0482_low_29
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0482_low_29
NF0482_low_29
[»] chr7 (3 HSPs)
chr7 (84-164)||(6333680-6333760)
chr7 (78-131)||(6326233-6326286)
chr7 (78-131)||(6242512-6242565)
[»] scaffold2079 (1 HSPs)
scaffold2079 (84-131)||(731-778)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 84 - 164
Target Start/End: Complemental strand, 6333760 - 6333680
Alignment:
84 caacttcaacttcatcagcttcaacaaggtaaataacttcaattttcagctgagtaactactaaaacattaaccttctctg 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6333760 caacttcaacttcatcagcttcaacaaggtaaataacttcaattttcagctgagtaactactaaaacattaaccttctctg 6333680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 78 - 131
Target Start/End: Complemental strand, 6326286 - 6326233
Alignment:
78 caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6326286 caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca 6326233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 78 - 131
Target Start/End: Original strand, 6242512 - 6242565
Alignment:
78 caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca 131  Q
    |||||| ||||| ||||||||| | ||||| |||||||||||||||||||||||    
6242512 caacttgaacttgaacttcatcggattcaataaggtaaataacttcaattttca 6242565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold2079 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold2079
Description:

Target: scaffold2079; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 131
Target Start/End: Original strand, 731 - 778
Alignment:
84 caacttcaacttcatcagcttcaacaaggtaaataacttcaattttca 131  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||    
731 caacttcaacttcatcagattcaacaaggtaaataacttcaattttca 778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University