View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_29 (Length: 268)
Name: NF0482_low_29
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_29 |
 | |
|
| [»] scaffold2079 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 84 - 164
Target Start/End: Complemental strand, 6333760 - 6333680
Alignment:
| Q |
84 |
caacttcaacttcatcagcttcaacaaggtaaataacttcaattttcagctgagtaactactaaaacattaaccttctctg |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6333760 |
caacttcaacttcatcagcttcaacaaggtaaataacttcaattttcagctgagtaactactaaaacattaaccttctctg |
6333680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 78 - 131
Target Start/End: Complemental strand, 6326286 - 6326233
Alignment:
| Q |
78 |
caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6326286 |
caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca |
6326233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 78 - 131
Target Start/End: Original strand, 6242512 - 6242565
Alignment:
| Q |
78 |
caacttcaacttcaacttcatcagcttcaacaaggtaaataacttcaattttca |
131 |
Q |
| |
|
|||||| ||||| ||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
6242512 |
caacttgaacttgaacttcatcggattcaataaggtaaataacttcaattttca |
6242565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2079 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold2079
Description:
Target: scaffold2079; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 84 - 131
Target Start/End: Original strand, 731 - 778
Alignment:
| Q |
84 |
caacttcaacttcatcagcttcaacaaggtaaataacttcaattttca |
131 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
731 |
caacttcaacttcatcagattcaacaaggtaaataacttcaattttca |
778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 80 times since January 2019
Visitors: 3464