View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_30 (Length: 264)
Name: NF0482_low_30
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 44 - 173
Target Start/End: Complemental strand, 17212299 - 17212170
Alignment:
Q |
44 |
catcatcaccttcttgacaaaattaaaattcaatatttttggtggttaaatctaaaacatgtcaactttgctttgaactatcatttgtgatgacataatc |
143 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| | ||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
T |
17212299 |
catcatcaccttcttgacaaaattaaaattcaatctttttggttgttaaatgtgaaacatgtcaactttgctttgaactatcatttgtggtggcataatc |
17212200 |
T |
 |
Q |
144 |
ctctgagttttgtgatatcagttacttaac |
173 |
Q |
|
|
|| ||||||| | |||||| || |||||| |
|
|
T |
17212199 |
cttcgagttttataatatcatttccttaac |
17212170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 46 - 107
Target Start/End: Complemental strand, 38758185 - 38758124
Alignment:
Q |
46 |
tcatcaccttcttgacaaaattaaaattcaatatttttggtggttaaatctaaaacatgtca |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||| ||||| ||| |||||||||||| |
|
|
T |
38758185 |
tcatcaccttcttgacaaaattaaaattcaatctttttgatggttgaatgtaaaacatgtca |
38758124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 77
Target Start/End: Complemental strand, 39778308 - 39778277
Alignment:
Q |
46 |
tcatcaccttcttgacaaaattaaaattcaat |
77 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
39778308 |
tcatcaccttcttgacaaaattaaaattcaat |
39778277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University