View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0482_low_30 (Length: 264)

Name: NF0482_low_30
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0482_low_30
NF0482_low_30
[»] chr6 (1 HSPs)
chr6 (44-173)||(17212170-17212299)
[»] chr5 (2 HSPs)
chr5 (46-107)||(38758124-38758185)
chr5 (46-77)||(39778277-39778308)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 44 - 173
Target Start/End: Complemental strand, 17212299 - 17212170
Alignment:
44 catcatcaccttcttgacaaaattaaaattcaatatttttggtggttaaatctaaaacatgtcaactttgctttgaactatcatttgtgatgacataatc 143  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||| | ||||||||||||||||||||||||||||||||||| || |||||||    
17212299 catcatcaccttcttgacaaaattaaaattcaatctttttggttgttaaatgtgaaacatgtcaactttgctttgaactatcatttgtggtggcataatc 17212200  T
144 ctctgagttttgtgatatcagttacttaac 173  Q
    ||  ||||||| | |||||| || ||||||    
17212199 cttcgagttttataatatcatttccttaac 17212170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 46 - 107
Target Start/End: Complemental strand, 38758185 - 38758124
Alignment:
46 tcatcaccttcttgacaaaattaaaattcaatatttttggtggttaaatctaaaacatgtca 107  Q
    |||||||||||||||||||||||||||||||| |||||| ||||| ||| ||||||||||||    
38758185 tcatcaccttcttgacaaaattaaaattcaatctttttgatggttgaatgtaaaacatgtca 38758124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 46 - 77
Target Start/End: Complemental strand, 39778308 - 39778277
Alignment:
46 tcatcaccttcttgacaaaattaaaattcaat 77  Q
    ||||||||||||||||||||||||||||||||    
39778308 tcatcaccttcttgacaaaattaaaattcaat 39778277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 559 times since January 2019
Visitors: 3483