View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_35 (Length: 239)
Name: NF0482_low_35
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0482_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 1816089 - 1815929
Alignment:
| Q |
1 |
ggacttacttttctattttaaattaagggcattataaaaaactttcttacaaatccttaagagattaattttatgcacaggtcatgtaaaactttgttac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1816089 |
ggacttacttttctattttaaattaaggacattataaaaaactttcttacaaatccttaagagattaattttatgcacaggtcatgtaaaactttgttac |
1815990 |
T |
 |
| Q |
101 |
acatgcatccaatcaaattcaatgagtaatgaatgaaagcagttggttagttagttagtta |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1815989 |
acatgcatccaatcaaattcaatgagtaatgaatgaaagcagttagttagttagttagtta |
1815929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 87 - 119
Target Start/End: Original strand, 19726792 - 19726824
Alignment:
| Q |
87 |
taaaactttgttacacatgcatccaatcaaatt |
119 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
19726792 |
taaaacttttttacacatgcatccaatcaaatt |
19726824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University