View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0482_low_39 (Length: 231)
Name: NF0482_low_39
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0482_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 77 - 226
Target Start/End: Complemental strand, 34122664 - 34122515
Alignment:
Q |
77 |
atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt |
176 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34122664 |
atatttctcctgttataaaaataaaatgaatttttcaatcaaccaaaaatatgttaccctaagaatgacactatacattgatggacattgttgttattgt |
34122565 |
T |
 |
Q |
177 |
tcatctattgatgattcttattacaacatctttcccatatattcttggac |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| | |||||| |
|
|
T |
34122564 |
tcatctattgatgattcttattacaacatctttcccatatactgttggac |
34122515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University