View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0482_low_40 (Length: 228)

Name: NF0482_low_40
Description: NF0482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0482_low_40
NF0482_low_40
[»] chr3 (2 HSPs)
chr3 (89-228)||(26431387-26431526)
chr3 (89-228)||(11898467-11898606)
[»] chr4 (1 HSPs)
chr4 (116-205)||(53321255-53321344)
[»] chr2 (1 HSPs)
chr2 (89-228)||(14652369-14652508)
[»] chr1 (2 HSPs)
chr1 (89-228)||(20286168-20286307)
chr1 (104-210)||(24530277-24530383)
[»] chr8 (1 HSPs)
chr8 (89-228)||(23131274-23131413)


Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 89 - 228
Target Start/End: Complemental strand, 26431526 - 26431387
Alignment:
89 aagctaaagacccccgaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctcctt 188  Q
    |||||||||||| | ||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||    
26431526 aagctaaagaccgcagaaaaattcaatctgttgatttggttggcttgccacaatgcgatcccgactttatcacttctccaccaccgtcagatggctcctt 26431427  T
189 cctccacctgttcgagatgtggcgaagaagaagaaaccat 228  Q
    |||| ||||||||| ||||||||||||| |||||||||||    
26431426 cctcaacctgttcgcgatgtggcgaagacgaagaaaccat 26431387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 89 - 228
Target Start/End: Original strand, 11898467 - 11898606
Alignment:
89 aagctaaagacccccgaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctcctt 188  Q
    ||||||||| |||| ||||||||||||||||| |||||| | |||||||| || || ||||||||| | || |||||| | |||||||| ||||| || |    
11898467 aagctaaagtcccctgaaaaattcaaactgtttatttggttagcttgccataacgccatcccgactatgtctcttctcgaacaccgtcatatggccccct 11898566  T
189 cctccacctgttcgagatgtggcgaagaagaagaaaccat 228  Q
    | ||||||||||| |||||||| ||||| |||||||||||    
11898567 cttccacctgttccagatgtggagaagacgaagaaaccat 11898606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 116 - 205
Target Start/End: Original strand, 53321255 - 53321344
Alignment:
116 ctgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctccttcctccacctgttcgaga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
53321255 ctgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctccctcctccacctgttcgaga 53321344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 89 - 228
Target Start/End: Complemental strand, 14652508 - 14652369
Alignment:
89 aagctaaagacccccgaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctcctt 188  Q
    ||||||||  |||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||| |||||||| ||||| || |||||||| |    
14652508 aagctaaaatcccccgaaaaattcaaactgttgatttggctggcttgccataacgcgatcccgactctatctcttctccaacaccgacatatggctccct 14652409  T
189 cctccacctgttcgagatgtggcgaagaagaagaaaccat 228  Q
    | || ||||||||||||||||| ||||| |||||||||||    
14652408 cttctacctgttcgagatgtggagaagacgaagaaaccat 14652369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 89 - 228
Target Start/End: Original strand, 20286168 - 20286307
Alignment:
89 aagctaaagacccccgaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctcctt 188  Q
    ||||||||| |||| ||||||||||||||||| |||||| | |||||||| || || ||||||||| | || |||||| | |||||||| ||||| || |    
20286168 aagctaaagtcccctgaaaaattcaaactgttcatttggttagcttgccataacgccatcccgactatgtctcttctcgaacaccgtcatatggccccct 20286267  T
189 cctccacctgttcgagatgtggcgaagaagaagaaaccat 228  Q
    | ||||||||||| |||||||| ||||| |||||||||||    
20286268 cttccacctgttccagatgtggagaagacgaagaaaccat 20286307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 210
Target Start/End: Original strand, 24530277 - 24530383
Alignment:
104 gaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctccttcctccacctgttcga 203  Q
    ||||||||||| |||||||||||||| | ||||||||| ||  | ||  ||||||| ||  ||||||||| ||| || ||||| ||  | ||||||||||    
24530277 gaaaaattcaagctgttgatttggctagtttgccacaacgctgttccagctttatccctgatccatcaccatcacatagctccctctactacctgttcga 24530376  T
204 gatgtgg 210  Q
    |||||||    
24530377 gatgtgg 24530383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 89 - 228
Target Start/End: Complemental strand, 23131413 - 23131274
Alignment:
89 aagctaaagacccccgaaaaattcaaactgttgatttggctggcttgccacaatgcgatcccgactttatcacttctccatcaccgtcaaatggctcctt 188  Q
    ||||||||| |||| |||||||||||||||||||||||| | |||||||| || || || |||||  | || ||| || | |||||||| ||||| || |    
23131413 aagctaaagtcccctgaaaaattcaaactgttgatttggttagcttgccataacgccattccgacaatgtctcttttcgaacaccgtcatatggccccct 23131314  T
189 cctccacctgttcgagatgtggcgaagaagaagaaaccat 228  Q
    | ||||||||||| |||||||| ||||| |||||||||||    
23131313 cttccacctgttccagatgtggagaagacgaagaaaccat 23131274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University