View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0483_high_2 (Length: 248)
Name: NF0483_high_2
Description: NF0483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0483_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 12 - 161
Target Start/End: Original strand, 56312444 - 56312593
Alignment:
Q |
12 |
gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcagataggatgattcgaactgaaaacttccgttca |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
56312444 |
gaagtatcgaaacggtgatcgtccaaatcgtgtaacaacttctggttattggaaggcaacaggagcggataggatgattcgaactgaaaacttccgttca |
56312543 |
T |
 |
Q |
112 |
attggactcaagaaaaccctagttttctattctggaaaagctcctaaagg |
161 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56312544 |
attggactcaagaaaaccctagttttctattctggaaaagctcctaaagg |
56312593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 3428446 - 3428365
Alignment:
Q |
157 |
aaaggtttccttacatgatatacataactgttctagaaaaatagaaaatagagggaaagttaggagatcaaggagcaaaaac |
238 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
3428446 |
aaaggtttccttacatgatatacataactgttctagaaaaatagaaaatatagggaaagttaggagatcaaggagcaaaaac |
3428365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University