View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0483_low_5 (Length: 291)
Name: NF0483_low_5
Description: NF0483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0483_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 51390626 - 51390827
Alignment:
| Q |
1 |
ctgatggtctttctttggatgaattgcgtcgcaggagaattgaaaggtttggtaggtgatgaaatgtaatcatgatgatagtagaaatgaaatattaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51390626 |
ctgatggtctttctttggatgaattgcgtcgcaggagaattgaaaggtttggtaggtgatgaaatgtaatcatgatgatagtagaaatgaaatattaaca |
51390725 |
T |
 |
| Q |
101 |
aataatgcaattggatgtagaaatttagttcattctattggatattagacttgtttttattttagatggatataagtttgttgtgtaactagagctgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51390726 |
aataatgcaattggatgtagaaatttagttcattctattggatattagacttgtttttattttagatggatataagtttgttgtgtaactagagctgatg |
51390825 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
51390826 |
at |
51390827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University