View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_high_10 (Length: 272)
Name: NF0484_high_10
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0484_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 62 - 262
Target Start/End: Original strand, 22665337 - 22665537
Alignment:
| Q |
62 |
aactataacacagcataccagcttagaagtttaactaaaactgttgaacacaaaggacattcaaaataacaaagttgcgtcagatccattggatccaacg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
22665337 |
aactataacacagcataccagcttagaagtttaactaaaactgttgaacacaaaggacattcaaaaaaacaaagttgcgtcagatccaatggatccaacg |
22665436 |
T |
|
| Q |
162 |
caacaaacgtaacataaacgcattgtctctcccgaataaatcatctttagacaaaggcctctagactccctccagtatccaactgatacacctcacctat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22665437 |
caacaaacgtaacataaacgcattgtctctcccgactaaatcatctttagacaaaggcctctagactccctccagtatccaactgatacacctcacctat |
22665536 |
T |
|
| Q |
262 |
g |
262 |
Q |
| |
|
| |
|
|
| T |
22665537 |
g |
22665537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 216 times since January 2019
Visitors: 3465