View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_high_7 (Length: 284)
Name: NF0484_high_7
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0484_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 30 - 155
Target Start/End: Complemental strand, 47517227 - 47517102
Alignment:
| Q |
30 |
aaatggacatcgaaggaataggtgttgcgtgttttctggttctgcgaagcagtacacacaaaacctttgatgtggtgaggttaagatgccccttttgaac |
129 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47517227 |
aaatgggcatcgaaggaataggtgttgcgtgttttctggttctgcgaagcagcacacacaaaacctttgatgtggtgaggttaagatgccccttttgaac |
47517128 |
T |
 |
| Q |
130 |
aaattatctcttgtcgccaatctatc |
155 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
47517127 |
aaattatctcttgtcgccaatctatc |
47517102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 157 - 270
Target Start/End: Complemental strand, 47517028 - 47516915
Alignment:
| Q |
157 |
tccatattttctgctgaaaaactaaccttggacagcaatgagtaatatgattttaccgtaaaactgcacggtggatccagagccgaaacccatgaatctg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47517028 |
tccatattttctgctgaaaaactaaccttagacagcaatgagtaatatgattttaccgtaaaactgcacggtggatccagagccgaaacccatgaatctg |
47516929 |
T |
 |
| Q |
257 |
ctatattttctgcc |
270 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47516928 |
ctatattttctgcc |
47516915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University