View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_high_9 (Length: 278)
Name: NF0484_high_9
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0484_high_9 |
 |  |
|
[»] scaffold0279 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 155
Target Start/End: Original strand, 27532618 - 27532772
Alignment:
Q |
1 |
aattaattttaaatgatctcggttgttgatttgcaattggacaaccaagatctctaactacgtcacagcagatctatttccatactgtactgtacttcat |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||| |
|
|
T |
27532618 |
aattaattttaaatgatctcggttgttgatttgcaattggacaaccaagatctctaactgcgtcacagcagatctatttccgtattgtactgtacttcat |
27532717 |
T |
 |
Q |
101 |
ttttcactggttcaccggtgaaggtttactgcaggctcctcttcttctaggctgt |
155 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
27532718 |
ttttcactggttcaccggtgaaggtttattgcaggctcctcttcttctaggctgt |
27532772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 151
Target Start/End: Original strand, 27526966 - 27526998
Alignment:
Q |
119 |
tgaaggtttactgcaggctcctcttcttctagg |
151 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
27526966 |
tgaaggtttattgcaggctcctcttcttctagg |
27526998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0279 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0279
Description:
Target: scaffold0279; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 119 - 151
Target Start/End: Original strand, 20847 - 20879
Alignment:
Q |
119 |
tgaaggtttactgcaggctcctcttcttctagg |
151 |
Q |
|
|
|||||||||| |||||||||||||||||||||| |
|
|
T |
20847 |
tgaaggtttattgcaggctcctcttcttctagg |
20879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University