View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_low_12 (Length: 279)
Name: NF0484_low_12
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0484_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 45 - 231
Target Start/End: Complemental strand, 15702760 - 15702574
Alignment:
| Q |
45 |
agatggacatcatctttccaccacactccgtcgacatctttcagtttcttaattgcatttgctttcctcctctggtcggccttgctatggaaaatttttg |
144 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702760 |
agatggtcatcacctttccaccacactccgaagacatctttcagtttcttaattgcatttgttttcctcctctggtcggccttgctatggaaaatttttg |
15702661 |
T |
 |
| Q |
145 |
tattactatcaccatccttcaaccatactgccatacttctctgcctccacaaaacctcatctgttctcaacaggttgtctctctgct |
231 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15702660 |
tatttctatccccatccttcaaccatactgccctactcctctgcctccacaaaaccttatctgttctcaacaggttgtctctctgct |
15702574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University