View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_low_3 (Length: 384)
Name: NF0484_low_3
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0484_low_3 |
 |  |
|
| [»] scaffold0856 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0856 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: scaffold0856
Description:
Target: scaffold0856; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 101 - 373
Target Start/End: Original strand, 4272 - 4544
Alignment:
| Q |
101 |
ctgtaatcttctgatggcggcctggtagtgaatgaacttgttggttgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgacc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4272 |
ctgtaatcttctgatggtggcctggtagtgaatgaacttgttggttgaggtttggagacatgttgactcaattgtcggatggtgaaagagataactgacc |
4371 |
T |
 |
| Q |
201 |
aggtagtaggttaagtatacaattcatctacacttggattcatgatcatcaaatacaaatcatgtttcaactcaacccactgccgaaccgattctttgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4372 |
aggtagtaggttaagtatacaattcatctacacttggattcatgatcatcaaatacaaatcatgtttcaactcaacccactgccgaaccggttctttgtc |
4471 |
T |
 |
| Q |
301 |
aatctgcatccattgtaggctaggacatatttctaattaagattctacctcctccctatggctacctctctct |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4472 |
aatctgcatccattgtaggctaggacatatttctaattaagattctacctcctccctatggctacctctctct |
4544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 6 - 81
Target Start/End: Original strand, 23528862 - 23528937
Alignment:
| Q |
6 |
atatgtccctgtgtgtgtcccatgattggactccccctcatcttaacaattttgttttacttaaaataaggctgaa |
81 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23528862 |
atatgtccttgtgtgtgtcccatgattgaactccccctcatcttaacaattttgttttacttaaaataaggctgaa |
23528937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University