View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0484_low_9 (Length: 315)
Name: NF0484_low_9
Description: NF0484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0484_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 81 - 203
Target Start/End: Original strand, 31296814 - 31296936
Alignment:
| Q |
81 |
tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31296814 |
tgaatgctaatcatgttggtattaatctaggaagtcttgtatctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagtt |
31296913 |
T |
 |
| Q |
181 |
gaaatcttgggttgattatgata |
203 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31296914 |
gaaatcttgggttgattatgata |
31296936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 190
Target Start/End: Complemental strand, 13358527 - 13358460
Alignment:
| Q |
122 |
tctgttgctgttgcaaatgtttctaaatcgaatttggttttgaatagtggtgaaaagttgaaatcttgg |
190 |
Q |
| |
|
||||||| ||||||||| ||||| |||| |||||||||| || |||| |||||||| ||||||||||| |
|
|
| T |
13358527 |
tctgttgttgttgcaaa-gtttcaaaatagaatttggttctggatagctgtgaaaagatgaaatcttgg |
13358460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University