View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0485-Insertion-4 (Length: 266)
Name: NF0485-Insertion-4
Description: NF0485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0485-Insertion-4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 13 - 266
Target Start/End: Original strand, 13134266 - 13134519
Alignment:
| Q |
13 |
aaaggtatatatgatgatgatggagagcccagatctttccccacctcaaatagacacatctcgaccgtccctcggtttcccactaggtactgctctcctc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13134266 |
aaaggtatatatgatgatgatggagagcccagatctttccccacctcaaatagacacatctcgaccgtccctcggtttcccactaggtactgctctcctc |
13134365 |
T |
 |
| Q |
113 |
ttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttcgttcacttcatcaatctctccctcatcttgaggctgcac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13134366 |
ttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttcgttcacttcatcaatctctctctcatcttgaggctgcac |
13134465 |
T |
 |
| Q |
213 |
aagcacatacccaatccccaccttccaagtctaaacctcactccacggtaacaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13134466 |
aagcacatacccaatccccaccttccaagtctaaacctcactccacggtaacaa |
13134519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 96 - 227
Target Start/End: Complemental strand, 30237300 - 30237169
Alignment:
| Q |
96 |
taggtactgctctcctcttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttcgttcacttcatcaatctctccc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
30237300 |
taggtactgctctcctcttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactgggaaaagtttctttcacttcatcaatctctctc |
30237201 |
T |
 |
| Q |
196 |
tcatcttgaggctgcacaagcacatacccaat |
227 |
Q |
| |
|
|||||||||| || ||||||||||||| |||| |
|
|
| T |
30237200 |
tcatcttgagtctccacaagcacatactcaat |
30237169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 61
Target Start/End: Complemental strand, 30237337 - 30237302
Alignment:
| Q |
26 |
atgatgatggagagcccagatctttccccacctcaa |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30237337 |
atgatgatggagagcccagatctttccccacctcaa |
30237302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 69 - 165
Target Start/End: Original strand, 28232718 - 28232814
Alignment:
| Q |
69 |
catctcgaccgtccctcggtttcccactaggtactgctctcctcttgctcatcatcttcagcttaagtggtatcttctcatgttgctaccactggga |
165 |
Q |
| |
|
|||||||||| ||||| |||||||| | || ||||| || |||||| ||||||| || ||||| ||||||||| |||| ||||||||||| ||||| |
|
|
| T |
28232718 |
catctcgaccatcccttggtttccctttgggcactgcccttctcttgatcatcatttttagcttgagtggtatcctctcttgttgctaccattggga |
28232814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University