View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_high_21 (Length: 323)
Name: NF0486_high_21
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_high_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 77 - 235
Target Start/End: Original strand, 35185648 - 35185806
Alignment:
| Q |
77 |
gagagggatggattttggtggaagaaaaatttaaaatatattttgtcccttaacttaaacgaggctgcaaaggatatcatggcatccccttaattcaggg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35185648 |
gagagggatggattttggtggaagaaaaatttaaaatatattttgtcccttaacttaaacgaggctgcaaaggatatcatggcatccccttaattcaggg |
35185747 |
T |
|
| Q |
177 |
caagagaacaggttaatttggattgcggatcataatggatgctatttggttgaatccgg |
235 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35185748 |
caagagaacgggttaatttggattgcggatcataatggatgctatttggttgaatccgg |
35185806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 565 times since January 2019
Visitors: 3483