View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_high_22 (Length: 311)
Name: NF0486_high_22
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0486_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 22 - 223
Target Start/End: Original strand, 35613122 - 35613323
Alignment:
Q |
22 |
tgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaaggtcatagcaggatagagggcaggtttatctggctttaccaattcct |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
T |
35613122 |
tgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaaggtcatagcagggtagagggcaggtttatctggctttaccaattctt |
35613221 |
T |
 |
Q |
122 |
tagctggctctattggaatgtcactttttggattgtagaagaaagctaaggaaactctctctttgtgtgagtttgctagtactctgtgctctacactcct |
221 |
Q |
|
|
| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
35613222 |
ttgctggctctattggaatgtcacttttgggattgtagaagaaggctaaggaaactctctctttgtgtgagtttgctattactctatgctctacactcct |
35613321 |
T |
 |
Q |
222 |
gt |
223 |
Q |
|
|
|| |
|
|
T |
35613322 |
gt |
35613323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 99
Target Start/End: Original strand, 31789756 - 31789833
Alignment:
Q |
22 |
tgagattttccacatggacccctcattctaatgaaaagcctatattcatcaaaggtcatagcaggatagagggcaggt |
99 |
Q |
|
|
|||||||| ||||| || ||||||||||||||||| || || || |||||||||||||| || || ||||| |||||| |
|
|
T |
31789756 |
tgagatttgccacaaggtcccctcattctaatgaagagtctgtactcatcaaaggtcattgctgggtagagtgcaggt |
31789833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 387 times since January 2019
Visitors: 3472