View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_high_27 (Length: 267)
Name: NF0486_high_27
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 165
Target Start/End: Original strand, 52762005 - 52762168
Alignment:
| Q |
1 |
tagtccgaagcgtcatcaagaatgcaaagtgagaaaggacaaagattggtaattaaaggattcatacatctttgaattgaaaaaggccgagatcgccaag |
100 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762005 |
tagtccgaagcgtcataaagaatacaaagtgagaa-ggacaaagattggtaattaaaggattcatacatctttgaattgaaaaaggccgagatcgccaag |
52762103 |
T |
 |
| Q |
101 |
gtaagagatggatcgctgagctgattcaattggaatgatcaattgaacaagtttcacaggttctg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
52762104 |
gtaagagatggatcgctgagctgattcaattggaatgatcaattgaacaagttgcataggttctg |
52762168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University