View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_high_30 (Length: 256)
Name: NF0486_high_30
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_high_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 12088711 - 12088824
Alignment:
| Q |
137 |
aatatcatcataattaacaatagtctcacctcatatattaacaccaccaccaccatttacgtccatataactacaccaattatgccactacaaactttta |
236 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12088711 |
aatatcatcaaaattaacaatagtctcacctcatat--taacaccaccaccaccatttacgtccatataactacaccagttatgccactacaaactttta |
12088808 |
T |
 |
| Q |
237 |
ctatatactttaagaa |
252 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
12088809 |
ctatatacattaagaa |
12088824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University