View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0486_high_31 (Length: 254)

Name: NF0486_high_31
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0486_high_31
NF0486_high_31
[»] chr5 (1 HSPs)
chr5 (174-254)||(34817584-34817664)


Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 174 - 254
Target Start/End: Complemental strand, 34817664 - 34817584
Alignment:
174 caaattcaaatttctcataacattttcatcttctccatagtttctagaagaaataaacaatgttctattcacaccagcttc 254  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34817664 caaattcaaatttctcataacattttcatcttctccatagtttctagaagaaataaacaatgttctattcacaccagcttc 34817584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 202 times since January 2019
Visitors: 3465