View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_high_51 (Length: 204)
Name: NF0486_high_51
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_high_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 38180172 - 38180299
Alignment:
| Q |
1 |
atatttgaagataataaaaaagagggaaggtcacgactttcaagagagaatgacaatcctggtaatgatattgaacatgtttcatcctttgatttgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38180172 |
atatttgaagataataaaaaagagggaaggtcacggctttcaagagagaatgacaatcctggtaatgatattgaacatgtttcatcctttgatttgtttg |
38180271 |
T |
|
| Q |
101 |
tgatgtagtcaccatgctcatgaaagta |
128 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
38180272 |
tgacgtagtcaccatgctcatgaaagta |
38180299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 38184841 - 38184968
Alignment:
| Q |
1 |
atatttgaagataataaaaaagagggaaggtcacgactttcaagagagaatgacaatcctggtaatgatattgaacatgtttcatcctttgatttgtttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38184841 |
atatttgaagataataaaaaagagggaaggtcacggctttcaagagagaatgacaatcctggtaatgatattgaacatgtttcatcctttgatttgtttg |
38184940 |
T |
|
| Q |
101 |
tgatgtagtcaccatgctcatgaaagta |
128 |
Q |
| |
|
|||||||||||||||| ||||||||||| |
|
|
| T |
38184941 |
tgatgtagtcaccatgttcatgaaagta |
38184968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 2 - 128
Target Start/End: Original strand, 38170359 - 38170485
Alignment:
| Q |
2 |
tatttgaagataataaaaaagagggaaggtcacgactttcaagagagaatgacaatcctggtaatgatattgaacatgtttcatcctttgatttgtttgt |
101 |
Q |
| |
|
||||||||| |||||||||||||||||||| || |||| |||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
38170359 |
tatttgaagccaataaaaaagagggaaggtcgcggcttttaagagagaatgacaatcccggtaatgatattaaacacgtttcatcctttgatttgtttgt |
38170458 |
T |
|
| Q |
102 |
gatgtagtcaccatgctcatgaaagta |
128 |
Q |
| |
|
|||||||||||| || ||||||||||| |
|
|
| T |
38170459 |
gatgtagtcaccgtgttcatgaaagta |
38170485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 373 times since January 2019
Visitors: 3472