View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_18 (Length: 410)
Name: NF0486_low_18
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 31 - 241
Target Start/End: Original strand, 5022429 - 5022639
Alignment:
| Q |
31 |
gtagatgatgtctcacttccgccaataagcatatcctgcaccatgatagtgagatctcatgaagaaagattcaaataatataattccattgggattgaaa |
130 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5022429 |
gtagatgatgtctcacttccaccaataagcatatcctgcaccatgatagtgagatctcatgaagaaagattcaaataatataattccattgggattgaaa |
5022528 |
T |
 |
| Q |
131 |
attcaagattctttgaaaatacagattacctctgtctagaatacttcattgtcttgcacattattcttagattagaaaaccaattaaaggaaaatgtaac |
230 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5022529 |
attcaagattatttgaaaatacagattacctctgtctagaatacttcattgtcttgcacattattcttagattagaaaaccaattaaaggaaaatgtaac |
5022628 |
T |
 |
| Q |
231 |
ttgaaacatag |
241 |
Q |
| |
|
||||||||||| |
|
|
| T |
5022629 |
ttgaaacatag |
5022639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 34 - 90
Target Start/End: Complemental strand, 41654360 - 41654304
Alignment:
| Q |
34 |
gatgatgtctcacttccgccaataagcatatcctgcaccatgatagtgagatctcat |
90 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||| | || ||||||||||||| |
|
|
| T |
41654360 |
gatgatgtctcacttccaccaataagcatagtctgcactaggagagtgagatctcat |
41654304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University