View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_19 (Length: 407)
Name: NF0486_low_19
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 173 - 386
Target Start/End: Original strand, 49542656 - 49542867
Alignment:
| Q |
173 |
gccagccagaagtgctcacccggtgatggcgtcacactgccttctcttgtcactgttttttactctcaattctctctgctaactggtaatttcaccttct |
272 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49542656 |
gccagccagaagtgctcacgcggtgatggcgtcacactgccttctcttgtcactgttttttactc--aattctctctgctaactggtaatttcaccttct |
49542753 |
T |
|
| Q |
273 |
tcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttcttgctattcaaggtttatctatgtactttgttttgacctttttca |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49542754 |
tcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttcttgcttttcaaggtttatctatgtactttgttttgacctttttca |
49542853 |
T |
|
| Q |
373 |
caacttgctgctat |
386 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
49542854 |
caatttgctgctat |
49542867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 228 - 399
Target Start/End: Original strand, 47608047 - 47608215
Alignment:
| Q |
228 |
ttttttactctcaattctctctgctaactggtaatttcaccttcttcttcttcttcggttgcacattaactgtttgattcaatgaatgaacacgttcttc |
327 |
Q |
| |
|
|||||| | ||||||||||| |||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| |||| |||||||||||| |
|
|
| T |
47608047 |
tttttttcgctcaattctctatgctaaatggtaatttcaccttc---ttcttcttccgttgcacattaactatttgattcaacgaattaacacgttcttc |
47608143 |
T |
|
| Q |
328 |
ttgctattcaaggtttatctatgtactttgttttgacctttttcacaacttgctgctatagacttctctgct |
399 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | |||||||||||||| |||||||| ||| ||||||||| |
|
|
| T |
47608144 |
ttgcttttcaaggtttatctatgtactttgttctcacctttttcacaacctgctgctacagatttctctgct |
47608215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 115 - 175
Target Start/End: Original strand, 49542555 - 49542615
Alignment:
| Q |
115 |
tatgactggctatttcatgtacaatagttaaaattataaatcaccgatttctcctcatgcc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49542555 |
tatgactggctatttcatgtacaatagttaaaattataaatcaccaatttctcctcatgcc |
49542615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 274 - 315
Target Start/End: Complemental strand, 52894426 - 52894385
Alignment:
| Q |
274 |
cttcttcttcggttgcacattaactgtttgattcaatgaatg |
315 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
52894426 |
cttcttcttcggttgcacataaactgtttgattaaatgaatg |
52894385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1754 times since January 2019
Visitors: 3462