View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_28 (Length: 336)
Name: NF0486_low_28
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 5855993 - 5855756
Alignment:
| Q |
13 |
aatatccctagagaccaaacatcaagtaataacagttacctttatttttagcaacccattnnnnnnnnnnnnntcctttgtcttatcgattgtgatggaa |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5855993 |
aatatccctagagaccaaacataaagtaataacagttacctttatttttagcaacccattaaaaaaaa-----tcctctgtcttatcgattgtgatggaa |
5855899 |
T |
|
| Q |
113 |
aagaaagaatatatatggtttggtacgaaacactggaaagagttaaaaaagaaaacgagaataacattcaaccaaacaacgtaggccattttca------ |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5855898 |
aagaaagaatatatatggtttggtacgaaacactggaaagagttaaaaaagcaaacgagaaaaacattcaactaaacaacgtaggccattttcatagaaa |
5855799 |
T |
|
| Q |
207 |
--taatatttgtcaatatctcgtgctcagtagtggttgtctct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5855798 |
cttaatatttgtcaatatctcgtgctcagtagtggttgtctct |
5855756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 93 times since January 2019
Visitors: 3464