View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_32 (Length: 310)
Name: NF0486_low_32
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_32 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 90 - 310
Target Start/End: Original strand, 49293646 - 49293866
Alignment:
| Q |
90 |
attatggatacatatggtgtgcttttgcagccttttgcggttggcctgggtgaaccaaagtagattttgcaacaaaacgtggcgccttgacattttttac |
189 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
49293646 |
attatggatacatatgatgtgcttttgcagccttttgcggttggcctgggtgaaccaaaatagattttgcaacaaaacgtgtcgccttgaaattttttac |
49293745 |
T |
 |
| Q |
190 |
atgaacttcactttgcaccacaccaatattcttctaggctatagtggtggtgaccatgccacaatgagatacgataatattaacttctacattttcatgg |
289 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49293746 |
atgaacttcactttgtaccacaccaatattcttctaggctatagtggtggtgaccatgccacaatgagatacgataatattaacttttacattttcatgg |
49293845 |
T |
 |
| Q |
290 |
atctatctctagatatcaaca |
310 |
Q |
| |
|
|||| ||| ||||||||||| |
|
|
| T |
49293846 |
atctttctagagatatcaaca |
49293866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 161 - 226
Target Start/End: Original strand, 49288129 - 49288193
Alignment:
| Q |
161 |
acaaaacgtggcgccttgacattttttacatgaacttcactttgcaccacaccaatattcttctag |
226 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
49288129 |
acaaaacgtggcgacttgaaattttttacatgaacttcac-ttggaccataccaatattcttctag |
49288193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University