View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_38 (Length: 270)
Name: NF0486_low_38
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0486_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 155 - 260
Target Start/End: Original strand, 41493724 - 41493829
Alignment:
Q |
155 |
taacaacgtatattttgcttaagatcaacccaatacgtattgccgtgattttacaatatctacattttactattcttccaaaaggtttgttttatagctc |
254 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
41493724 |
taacaacgtatattttgcttaagatcaacccaatacgtattgctgtgattttacaatatctacattttactattcttcaaaaaggtttgttttatagctt |
41493823 |
T |
 |
Q |
255 |
cctatg |
260 |
Q |
|
|
|||||| |
|
|
T |
41493824 |
cctatg |
41493829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 35 - 98
Target Start/End: Original strand, 41493497 - 41493560
Alignment:
Q |
35 |
aaagaaatcgttataattgaaattatcaatttggatagatattcgtaattgataatatagatat |
98 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41493497 |
aaagaaatcgttataattgaaattatcaatttggatagatattcgtaattgataatatagatat |
41493560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 103 - 142
Target Start/End: Complemental strand, 41493610 - 41493571
Alignment:
Q |
103 |
atctaatgacgagttccaacgtttacaagtaaaaaagata |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41493610 |
atctaatgacgagttccaacgtttacaagtaaaaaagata |
41493571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University