View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_41 (Length: 266)
Name: NF0486_low_41
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 3 - 173
Target Start/End: Complemental strand, 52762027 - 52761857
Alignment:
| Q |
3 |
attcttgatgacgcttcggactacattttccataatgttgagatgttcttcatctatctgaattagcattatttatatactacattgataaatcttgttt |
102 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52762027 |
attctttatgacgcttcggactacattttccataatgttgagatgttcttcatctatctgaattagcattatttatatactacattgataaatcttgttt |
52761928 |
T |
|
| Q |
103 |
aaatcaattcttcagcttaatgaagataaaagcccattccaacagacctacgcttcacaggtacctataac |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52761927 |
aaatcaattcttcagcttaatgaagataaaagcccattccaacagacctacgcttcacaggtacctataac |
52761857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1580 times since January 2019
Visitors: 3458