View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0486_low_43 (Length: 256)

Name: NF0486_low_43
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0486_low_43
NF0486_low_43
[»] chr3 (1 HSPs)
chr3 (137-252)||(12088711-12088824)


Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 137 - 252
Target Start/End: Original strand, 12088711 - 12088824
Alignment:
137 aatatcatcataattaacaatagtctcacctcatatattaacaccaccaccaccatttacgtccatataactacaccaattatgccactacaaactttta 236  Q
    |||||||||| |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
12088711 aatatcatcaaaattaacaatagtctcacctcatat--taacaccaccaccaccatttacgtccatataactacaccagttatgccactacaaactttta 12088808  T
237 ctatatactttaagaa 252  Q
    |||||||| |||||||    
12088809 ctatatacattaagaa 12088824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 348 times since January 2019
Visitors: 3470