View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_53 (Length: 235)
Name: NF0486_low_53
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_53 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 154 - 235
Target Start/End: Original strand, 34817527 - 34817608
Alignment:
| Q |
154 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34817527 |
atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt |
34817608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 235
Target Start/End: Original strand, 35867676 - 35867734
Alignment:
| Q |
177 |
taccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||| ||||| || |||||||| |
|
|
| T |
35867676 |
taccaaatttgaccgagaggtgcttttctagcaagaagctgatgtgagtaaaacattgt |
35867734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University