View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0486_low_54 (Length: 235)

Name: NF0486_low_54
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0486_low_54
NF0486_low_54
[»] chr5 (2 HSPs)
chr5 (154-235)||(34817527-34817608)
chr5 (177-235)||(35867676-35867734)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 154 - 235
Target Start/End: Original strand, 34817527 - 34817608
Alignment:
154 atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34817527 atgaatatgaaatgtgagattgataccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt 34817608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 177 - 235
Target Start/End: Original strand, 35867676 - 35867734
Alignment:
177 taccaaatttgaccgagaggtgctttgcgagctagaagctggtgtgaatagaacattgt 235  Q
    |||||||||||||||||||||||||| | ||| |||||||| ||||| || ||||||||    
35867676 taccaaatttgaccgagaggtgcttttctagcaagaagctgatgtgagtaaaacattgt 35867734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 47 times since January 2019
Visitors: 3463