View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_55 (Length: 232)
Name: NF0486_low_55
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0486_low_55 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 152 - 232
Target Start/End: Complemental strand, 34817664 - 34817584
Alignment:
Q |
152 |
caaattcaaatttctcataacattttcatcttctccatagtttctagaagaaataaacaatgttctattcacaccagcttc |
232 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34817664 |
caaattcaaatttctcataacattttcatcttctccatagtttctagaagaaataaacaatgttctattcacaccagcttc |
34817584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University