View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_56 (Length: 228)
Name: NF0486_low_56
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0486_low_56 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 39242124 - 39242342
Alignment:
Q |
10 |
gtttcttattatataatagatatgctttattaaagatgagattttctaagtacattttctttctctaattgaacctagcatagcaggttcaatgatttat |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39242124 |
gtttcttattatataatagatatgctttattaaagatgagattttctaagtacattttctttctctaattgaacctagcatagcaggttcaatgatttat |
39242223 |
T |
 |
Q |
110 |
tctgcttcttatggttctatcaagcaataaattttctcattattttcctttaacagtgctatagggaagtgactaagggcatgtatggagatcttggcaa |
209 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39242224 |
tctgcttcttatgtttctatcaagcaataaattttctcattattttcctttaacagtgctatagggaagtgactaagggcatgtatggagatcttggcaa |
39242323 |
T |
 |
Q |
210 |
agttatggaaggattcaac |
228 |
Q |
|
|
||||||||||||||||||| |
|
|
T |
39242324 |
agttatggaaggattcaac |
39242342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University