View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_66 (Length: 201)
Name: NF0486_low_66
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0486_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 7e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 38180196 - 38180096
Alignment:
| Q |
1 |
cctcttttttattatcttcaaatatatacactatcgctactcaatctttcaaagaacaaattcaagttctagatgaagaaaccaaccctaaagtacttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38180196 |
cctcttttttattatcttcaaatatatacactatcgctactcaatctttcaaagaacaaattcaagttctatatgaagaaaccaaccctaaagtacttgt |
38180097 |
T |
 |
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
38180096 |
t |
38180096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 38184865 - 38184765
Alignment:
| Q |
1 |
cctcttttttattatcttcaaatatatacactatcgctactcaatctttcaaagaacaaattcaagttctagatgaagaaaccaaccctaaagtacttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38184865 |
cctcttttttattatcttcaaatatatatactatcgctactcgatctttcaaagaacaaattcaagttctagatgaagaaaccaaccctacagtacttgt |
38184766 |
T |
 |
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
38184765 |
t |
38184765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University