View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0486_low_9 (Length: 575)
Name: NF0486_low_9
Description: NF0486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0486_low_9 |
 |  |
|
[»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 345; Significance: 0; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 159 - 575
Target Start/End: Original strand, 8152030 - 8152445
Alignment:
Q |
159 |
ccatcataggcaaactatcctatgaaattttgaattactttgtgcaatagagggacnnnnnnnnnnggttcttccgacctannnnnnnaatcaaaagcat |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
T |
8152030 |
ccatcataggcaaactatcctatgaaattttgaattactttgtgcaatagagggacaaaaaaaataggttcgtccgacctatttttt-aatcaaaagcat |
8152128 |
T |
 |
Q |
259 |
attcacgttgaattgtcccccgattctaattgcatgcatagttttgttacatttcatgctaattatgctagaaactgacttctacctcccactcaatttt |
358 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8152129 |
attcacgttgaattgtcccccgattctaattgcattcatagttttgttacatttcatgctaattatgctagaaactgacttctacctcccactcaatttt |
8152228 |
T |
 |
Q |
359 |
tatgaagtcttaaaacataggaccctagccactttctgcacataatttttggttgtgtgtccaccttttttccctcttttttatacgacgttttcggatt |
458 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
8152229 |
tatgaagtcttaaaacataggaccctagccactttctgcacataatttttggttgtgtgtccaccttttttccctcttttttatacgacattttcggatt |
8152328 |
T |
 |
Q |
459 |
atacctagtccaatttgtaagtgatatacactcaaaccctagccttatttcatttcctcttcctcatatacattgctgccgctttgcttctcattctcaa |
558 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8152329 |
atacctagtccaatttgtaagtgatatacactcaaaccctagccttatttcatttcctcttcctcatatacattgctgccgctttgcttctcattctcaa |
8152428 |
T |
 |
Q |
559 |
tctgtgccatgttcttc |
575 |
Q |
|
|
|||||| |||||||||| |
|
|
T |
8152429 |
tctgtgtcatgttcttc |
8152445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 160 - 214
Target Start/End: Original strand, 8134122 - 8134176
Alignment:
Q |
160 |
catcataggcaaactatcctatgaaattttgaattactttgtgcaatagagggac |
214 |
Q |
|
|
||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
T |
8134122 |
catcataggtaaactatcctttgaaattttgaattactttgtgcaatatagggac |
8134176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1557 times since January 2019
Visitors: 3458