View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0487_low_8 (Length: 242)
Name: NF0487_low_8
Description: NF0487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0487_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 36950006 - 36949906
Alignment:
| Q |
1 |
ggtggcagaacaatatatgttacatggaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttccc |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36950006 |
ggtggcagaaccatatatgttacatggaatgcctagtagatcacatatgcacc---ttattaatgtcaatagacacatggtatgttttttctcccttccc |
36949910 |
T |
 |
| Q |
101 |
atct |
104 |
Q |
| |
|
|||| |
|
|
| T |
36949909 |
atct |
36949906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 27 - 104
Target Start/End: Original strand, 10818104 - 10818181
Alignment:
| Q |
27 |
gaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatct |
104 |
Q |
| |
|
||||||||||||||||| ||||||| | | |||||||| |||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10818104 |
gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatct |
10818181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University