View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_high_10 (Length: 258)
Name: NF0488_high_10
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0488_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 44104791 - 44104567
Alignment:
Q |
6 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44104791 |
ttattcttgtaaaactgagataacataactggtccagcccatacacaaatttggattgctttttccttatttctattatcactattatttttatacaatt |
44104692 |
T |
 |
Q |
106 |
ctttagaatatttattgacatgttagtannnnnnnnattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaa-- |
203 |
Q |
|
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44104691 |
ctttagaatatttattgacatgttagtatattttttattcactgagatttgaattatgatcattggaactctcttaagactttgtttgtattgatgaaat |
44104592 |
T |
 |
Q |
204 |
--atatgatggaatggagtggtatg |
226 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
44104591 |
atatatgatggaatggagtggtatg |
44104567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University