View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_high_12 (Length: 231)
Name: NF0488_high_12
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0488_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 2489856 - 2490079
Alignment:
| Q |
1 |
acagtatgcttgggcagcgaacaagagttggggaacatgaagccatgcggaaaataaagaatgaattcatgtccaattgggatggacttacctcgaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2489856 |
acagtatgcttgggcagcgaacaagagttggggaacatgaagccatgcggaaaataaagaatgaattcatgtccaattgggatggacttacctcgaaatc |
2489955 |
T |
|
| Q |
101 |
agaggatcgtattcttgtcctcgctgcaaccaataggccctttgacttggatgaagcaattattagacgatttgaaagaaggtacctctactagttctac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2489956 |
agaggatcgtattcttgtcctcgctgcaaccaataggccctttgacttggatgaagcaattattagacgatttgaaagaaggtacctctactagttcgac |
2490055 |
T |
|
| Q |
201 |
atgtacaatgaattttttgtgctc |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2490056 |
atgtacaatgaattttttgtgctc |
2490079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 183
Target Start/End: Complemental strand, 41591125 - 41590948
Alignment:
| Q |
6 |
atgcttgggcagcgaacaagagttggggaacatgaagccatgcggaaaataaagaatgaattcatgtccaattgggatggacttacctcgaaatcagagg |
105 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||| || || || | ||| || | |
|
|
| T |
41591125 |
atgcttgggcaacgaacaagagttggggagcatgaagccatgcggaaaataaagaatgaatttatgtcccattgggacgggctcacgacaaaacaaggag |
41591026 |
T |
|
| Q |
106 |
atcgtattcttgtcctcgctgcaaccaataggccctttgacttggatgaagcaattattagacgatttgaaagaaggt |
183 |
Q |
| |
|
| || || ||||| || || |||||||||||||| ||||||||||||||||| ||||| || ||||||||||| |||| |
|
|
| T |
41591025 |
agcgcatccttgttcttgcagcaaccaataggccatttgacttggatgaagctattataaggcgatttgaaaggaggt |
41590948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 680 times since January 2019
Visitors: 3489