View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0488_high_13 (Length: 201)
Name: NF0488_high_13
Description: NF0488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0488_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 13 - 177
Target Start/End: Complemental strand, 49916242 - 49916082
Alignment:
Q |
13 |
gtgagatgaatagtaaatagtaagtatcctactaatcctactatatactctctccatacaaagtttaagcacaattctttctttattgtaaaagtatatt |
112 |
Q |
|
|
|||| |||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
49916242 |
gtgaaatgaatggtaaatagtaagtatgctactaatcctactatatactctctacatacaaagtttaagcacaattcttt----attgtaaaagtatatt |
49916147 |
T |
 |
Q |
113 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagatatatgtaacaggt |
177 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
49916146 |
tctaatgtggtgtcattctcatctttgctttggccaccaatcaccataagataaatgtaacaggt |
49916082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University